smart smartseq2  (10X Genomics)

Journal: Nature Communications

Article Title: devCellPy is a machine learning-enabled pipeline for automated annotation of complex multilayered single-cell transcriptomic data

doi: 10.1038/s41467-022-33045-x

Figure Lengend Snippet: A human iPSC line was genome-edited to introduce a TBX5 - Cre /LoxP lineage tracing system. Genome-edited hiPSCs were differentiated and collected for scRNA-seq using the ICELL8 Smart-seq2 system. devCellPy models used for murine ventricular cardiomyocyte subtype predictions were applied for the prediction of the hiPSC-CMs. a Schematic of dual TBX5-Cre / MYL2-TdTomato lineage tracing system. b workflow for collection of day 15 ICELL8 data from genome-edited cell line. c Feature plots showing the expression of TurboGFP , LV marker HAND1 , ventricular markers (MYL3, MYL2, MYH7, MPPED2), and atrial markers ( NR2F1, KCNA5, VSNL1, STARD10) . d Left, Representative flow cytometry plot of cardiac troponin T (TNNT2) and TurboGFP expression at day 35 of cardiomyocytes containing TBX5 -lineage tracing system. Right, Quantification of GFP-positive percentage among TNNT2 + cardiomyocytes among 17 independent biological replicate differentiations. Error bars represent standard error around the mean. e Left, Representative flow cytometry plot of MYL2-TdTomato and TurboGFP expression at day 35 of cardiomyocytes. Right, Quantification of GFP-positive percentage among TdTomato+ cardiomyocytes among 17 independent biological replicate differentiations. Error bars represent standard error around the mean. f Predictions of cardiomyocyte subtypes for day 15 hiPSC-CM using devCellPy E8.25 model and prediction probabilities. g Predictions of ventricular cardiomyocyte subtypes (left) of day 15 hiPSC-CM and prediction probabilities (right). Prediction probabilities indicate high overall confidence in LV predictions.

Article Snippet: We conducted single-cell capture and cDNA library generation using the Smartseq2 Takara ICELL8 single cell system (Takara Cat. No. 640000).

Techniques: Introduce, Expressing, Marker, Flow Cytometry

Journal: Developmental cell

Article Title: Reprogramming axial level identity to rescue neural crest-related congenital heart defects

doi: 10.1016/j.devcel.2020.04.005

Figure Lengend Snippet: Highlights:

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Mouse IgG1 anti-Pax7 Developmental Studies Hybridoma Bank at University of Iowa RRID: AB_528428 Rabbit anti-Sox2 Abcam Cat#ab97959; RRID: AB_2341193 Mouse IgG2b anti-MF20 Developmental Studies Hybridoma Bank at University of Iowa RRID: AB_2147781 Mouse IgM anti-HNK1 Developmental Studies Hybridoma Bank at University of Iowa RRID: AB_2314644 Mouse IgG2a anti-SMA Sigma Cat#3879S; RRID: AB_2255011 Mouse IgG2b anti-HuC/D Invitrogen Cat# A21271; RRID: AB_221448 Goat IgG anti-GFP Rockland Cat# 600-101-215; RRID: AB_218182 Mouse IgG2a anti-V5 Invitrogen Cat#R960–25; RRID: AB_2556564 Rabbit anti-RFP MBL Cat#PM005; RRID: AB_591279 Critical Commercial Assays RNAqueous Micro Total RNA isolation kit Ambion Cat#AM1931 SmartSeq2 V4 kit Takara Clontech Cat#634889 Nextera XT DNA library preparation kit Illumina Cat#FC-131–1024 Qubit High sensitivity DNA kit ThermoFisher Scientific Cat# {"type":"entrez-protein","attrs":{"text":"Q32854","term_id":"75280861","term_text":"Q32854"}} Q32854 NEB Next High-Fidelity 2X PCR Master Mix New England Biolabs Cat#M0543S NextSeq 500/550 High Output Kit v2 (75 cycles) Illumina Cat#FC-404–2005 Endofree maxi prep kit Macharey Nagel Cat#740426.50 Agencourt AMPure XP beads Beckman Coulter Cat#A63880 illustra MicroSpin G-50 Columns GE Healthcare Life Sciences Cat# 27533001 Hybridization Chain Reaction Molecular Technologies NA Deposited Data Raw and analyzed data This paper BioProject ID PRJNA515142 Software and Algorithms Fiji/ImageJ ( Schindelin et al., 2012 ) https://imagej.nih.gov/ij/ Bowtie2 ( Langmead and Salzberg, 2012 ) http://bowtie-bio.sourceforge.net/bowtie2/index.shtml Samtools http://samtools.sourceforge.net/ HTSeq-count https://htseq.readthedocs.io/en/release_0.11.1/count.html Seurat ( Butler et al., 2018 ) https://satijalab.org/seurat/ Oligonucleotides GCAGGTGTAGTTGCAATATC This paper Tgif1.1.gRNA GTTGGTCCCCCGCCGTGAGA This paper Tgif1.2.gRNA GGGTCATGTTGAGCATTTGG This paper Sox8.1.gRNA gTCCACCTTAGCGCCCAGCG This paper Sox8.2.gRNA GACGCGACGCCCATCCTCAA This paper Sox8.3.gRNA GGCCTCAACCATGAAGGCGG This paper Ets1.1.gRNA GACCTTCAGTGGCTTCGCAA This paper Ets1.2.gRNA GAGAGACGCACGTGCGGGAC This paper Ets1.3.gRNA GAAAGTCAGGCGCTAGCTCC This paper Ets1.4.gRNA Open in a separate window Highlights: Ablations reveal laterality differences in neural crest contributions to the heart Transcriptional profiling reveals Tgif1 as critical for outflow tract morphogenesis Sox8, Tgif1 , and Ets1 comprise a regulatory subcircuit for cardiac crest specification Expression of subcircuit genes in trunk reprograms them toward cardiac crest-like fate

Techniques: Isolation, Hybridization, Software

Journal: Developmental cell

Article Title: Reprogramming axial level identity to rescue neural crest-related congenital heart defects

doi: 10.1016/j.devcel.2020.04.005

Figure Lengend Snippet: Highlights:

Article Snippet: SmartSeq2 V4 kit , Takara Clontech , Cat#634889.

Techniques: Isolation, Hybridization, Software